OT: is this real?

[Fyron]

Those long words have been used in written form before. Look at the website. And they most assuredly symbolize a meaning. There is no way you can dispute that part, at least.

[Geckomlis]

Originally posted by Imperator Fyron:
What aspects of being a word do they not qualify for? They are properly constructed strings of letters that have a real, functional meaning.

word
meaningful unit of language sounds: a meaningful sound or combination of sounds that is a unit of language or its representation in a text.

[Fyron]

Which again is what those words are. They are quite meaningful units of language sounds.

[Fyron]

Would you consider "tetrachloride" a word?

[narf poit chez BOOM]

"a word is a unit of speech or writing that symbolizes or communicates a meaning. "

it doesn't say 'that has been used to'. so what i posted is a word.

now, if you limited the arguement to words in common usage...

[DavidG]

Originally posted by narf poit chez BOOM:

quote:

---

"a word is a unit of speech or writing that symbolizes or communicates a meaning. "

it doesn't say 'that has been used to'. so what i posted is a word.

---

I dispute the fact that these words 'communicate a meaning' You think a single person in the world can read or hear those words and get the specific meaning from them? and before anyone mentions it I think it is pretty clear that 'communicate a meaning' means to another human being. (else you could write the word out in binary and call it a long word)

intersting side note. The Guiness people also have a record for the longest 'real' word. (thus of course implying that they don't think DNA is a real word)

[Fyron]

Lets try this again. Is tetrachloride a "word"?

[Puke]

I consider "tetrachloride" to be a word. I do NOT consider the chemical representation of tetrachloride, "Cl4", to be a word. Thus, I do not consider ACGTTACGG to be a word, even though it does convey meaning.

I am hard pressed to come up with a strict definition, but it would probably involve being a component of language which can be used to construct a sentence or phrase. the simple ability to convey meaning is too broad, and my definition above is too poor. someone else will have to do better, but i think my first paragraph sums up the opinion of those arguing against Fyron.

[Will]

Considering the translation of the bases of DNA as a word is too much of a stretch on the definition for me. I'm not saying that things that might not be able to be communicated to another human being only verbally (ie, narf's original link) wouldn't be considered words. The sheer number of prefixes would prevent someone from being able to understand it completely just from the sound. However, it is properly constructed with English syllables, and it can be understood as an *English* word by stepping through it slowly.

DNA, however, simply consists of a long code of four letters, each one of which stands for a single word in itself. So the 'word' GGTGACTACGGTTTACAAAC is not a 20-character word, but rather a representation of a string of 20 words:
Guanine Guanine Thymine Guanine Adenine Cytosine Thymine Adenine Cytosine Guanine Guanine Thymine Thymine Thymine Adenine Cytosine Adenine Adenine Adenine Cytosine
So, in short, the 'name for human mitochondrial DNA' is not 207,000+ letters, but 207,000+ WORDS.

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it

[narf poit chez BOOM]

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it

and here i am, going to all the trouble of being witty!