.com.unity Forums
  The Official e-Store of Shrapnel Games

This Month's Specials

Raging Tiger- Save $9.00
winSPMBT: Main Battle Tank- Save $6.00

   







Go Back   .com.unity Forums > Shrapnel Community > Space Empires: IV & V

Reply
 
Thread Tools Display Modes
  #11  
Old December 24th, 2003, 06:45 PM
Fyron's Avatar

Fyron Fyron is offline
Shrapnel Fanatic
 
Join Date: Jul 2001
Location: Southern CA, USA
Posts: 18,394
Thanks: 0
Thanked 12 Times in 10 Posts
Fyron is an unknown quantity at this point
Default Re: OT: is this real?

Those long words have been used in written form before. Look at the website. And they most assuredly symbolize a meaning. There is no way you can dispute that part, at least.
__________________
It's not whether you win or lose that counts: it's how much pain you inflict along the way.
--- SpaceEmpires.net --- RSS --- SEnet ModWorks --- SEIV Modding 101 Tutorial
--- Join us in the #SpaceEmpires IRC channel on the Freenode IRC network.
--- Due to restrictively low sig limits, you must visit this link to view the rest of my signature.
Reply With Quote
  #12  
Old December 24th, 2003, 06:46 PM
Geckomlis's Avatar

Geckomlis Geckomlis is offline
Sergeant
 
Join Date: Dec 2002
Location: New Jesrey, USA
Posts: 292
Thanks: 0
Thanked 0 Times in 0 Posts
Geckomlis is on a distinguished road
Default Re: OT: is this real?

Quote:
Originally posted by Imperator Fyron:
What aspects of being a word do they not qualify for? They are properly constructed strings of letters that have a real, functional meaning.
word
meaningful unit of language sounds: a meaningful sound or combination of sounds that is a unit of language or its representation in a text.
__________________
Don't become a well-rounded person. Well rounded people are smooth and dull. Become a thoroughly spiky person. Grow spikes from every angle. Stick in their throats like a pufferfish
-Bruce Sterling
Reply With Quote
  #13  
Old December 24th, 2003, 06:55 PM
Fyron's Avatar

Fyron Fyron is offline
Shrapnel Fanatic
 
Join Date: Jul 2001
Location: Southern CA, USA
Posts: 18,394
Thanks: 0
Thanked 12 Times in 10 Posts
Fyron is an unknown quantity at this point
Default Re: OT: is this real?

Which again is what those words are. They are quite meaningful units of language sounds.
__________________
It's not whether you win or lose that counts: it's how much pain you inflict along the way.
--- SpaceEmpires.net --- RSS --- SEnet ModWorks --- SEIV Modding 101 Tutorial
--- Join us in the #SpaceEmpires IRC channel on the Freenode IRC network.
--- Due to restrictively low sig limits, you must visit this link to view the rest of my signature.
Reply With Quote
  #14  
Old December 24th, 2003, 06:57 PM
Fyron's Avatar

Fyron Fyron is offline
Shrapnel Fanatic
 
Join Date: Jul 2001
Location: Southern CA, USA
Posts: 18,394
Thanks: 0
Thanked 12 Times in 10 Posts
Fyron is an unknown quantity at this point
Default Re: OT: is this real?

Would you consider "tetrachloride" a word?
__________________
It's not whether you win or lose that counts: it's how much pain you inflict along the way.
--- SpaceEmpires.net --- RSS --- SEnet ModWorks --- SEIV Modding 101 Tutorial
--- Join us in the #SpaceEmpires IRC channel on the Freenode IRC network.
--- Due to restrictively low sig limits, you must visit this link to view the rest of my signature.
Reply With Quote
  #15  
Old December 24th, 2003, 10:07 PM
narf poit chez BOOM's Avatar

narf poit chez BOOM narf poit chez BOOM is offline
Shrapnel Fanatic
 
Join Date: Mar 2003
Location: CHEESE!
Posts: 10,009
Thanks: 0
Thanked 7 Times in 1 Post
narf poit chez BOOM is on a distinguished road
Default Re: OT: is this real?

Quote:
"a word is a unit of speech or writing that symbolizes or communicates a meaning. "
it doesn't say 'that has been used to'. so what i posted is a word.

now, if you limited the arguement to words in common usage...
__________________
If I only could remember half the things I'd forgot, that would be a lot of stuff, I think - I don't know; I forgot!
A* E* Se! Gd! $-- C-^- Ai** M-- S? Ss---- RA Pw? Fq Bb++@ Tcp? L++++
Some of my webcomics. I've got 400+ webcomics at Last count, some dead.
Sig updated to remove non-working links.
Reply With Quote
  #16  
Old December 26th, 2003, 04:22 AM
DavidG's Avatar

DavidG DavidG is offline
Lieutenant Colonel
 
Join Date: Jan 2002
Location: Dundas, Ontario, Canada
Posts: 1,498
Thanks: 0
Thanked 0 Times in 0 Posts
DavidG is on a distinguished road
Default Re: OT: is this real?

Quote:
Originally posted by narf poit chez BOOM:
quote:

"a word is a unit of speech or writing that symbolizes or communicates a meaning. "
it doesn't say 'that has been used to'. so what i posted is a word.


I dispute the fact that these words 'communicate a meaning' You think a single person in the world can read or hear those words and get the specific meaning from them? and before anyone mentions it I think it is pretty clear that 'communicate a meaning' means to another human being. (else you could write the word out in binary and call it a long word)

intersting side note. The Guiness people also have a record for the longest 'real' word. (thus of course implying that they don't think DNA is a real word)
__________________
SE4Modder ver 1.76
or for just the EXESE4Modder EXE Ver 1.76
SE4 Mod List
Reply With Quote
  #17  
Old December 26th, 2003, 04:24 AM
Fyron's Avatar

Fyron Fyron is offline
Shrapnel Fanatic
 
Join Date: Jul 2001
Location: Southern CA, USA
Posts: 18,394
Thanks: 0
Thanked 12 Times in 10 Posts
Fyron is an unknown quantity at this point
Default Re: OT: is this real?

Lets try this again. Is tetrachloride a "word"?
__________________
It's not whether you win or lose that counts: it's how much pain you inflict along the way.
--- SpaceEmpires.net --- RSS --- SEnet ModWorks --- SEIV Modding 101 Tutorial
--- Join us in the #SpaceEmpires IRC channel on the Freenode IRC network.
--- Due to restrictively low sig limits, you must visit this link to view the rest of my signature.
Reply With Quote
  #18  
Old December 26th, 2003, 06:54 AM
Puke's Avatar

Puke Puke is offline
Lieutenant General
 
Join Date: Dec 2000
Location: california
Posts: 2,961
Thanks: 0
Thanked 0 Times in 0 Posts
Puke is on a distinguished road
Default Re: OT: is this real?

I consider "tetrachloride" to be a word. I do NOT consider the chemical representation of tetrachloride, "Cl4", to be a word. Thus, I do not consider ACGTTACGG to be a word, even though it does convey meaning.

I am hard pressed to come up with a strict definition, but it would probably involve being a component of language which can be used to construct a sentence or phrase. the simple ability to convey meaning is too broad, and my definition above is too poor. someone else will have to do better, but i think my first paragraph sums up the opinion of those arguing against Fyron.
__________________
...the green, sticky spawn of the stars
(with apologies to H.P.L.)
Reply With Quote
  #19  
Old December 26th, 2003, 08:45 AM
Will's Avatar

Will Will is offline
Lieutenant Colonel
 
Join Date: Mar 2001
Location: Emeryville, CA
Posts: 1,412
Thanks: 0
Thanked 0 Times in 0 Posts
Will is on a distinguished road
Default Re: OT: is this real?

Considering the translation of the bases of DNA as a word is too much of a stretch on the definition for me. I'm not saying that things that might not be able to be communicated to another human being only verbally (ie, narf's original link) wouldn't be considered words. The sheer number of prefixes would prevent someone from being able to understand it completely just from the sound. However, it is properly constructed with English syllables, and it can be understood as an *English* word by stepping through it slowly.

DNA, however, simply consists of a long code of four letters, each one of which stands for a single word in itself. So the 'word' GGTGACTACGGTTTACAAAC is not a 20-character word, but rather a representation of a string of 20 words:
Guanine Guanine Thymine Guanine Adenine Cytosine Thymine Adenine Cytosine Guanine Guanine Thymine Thymine Thymine Adenine Cytosine Adenine Adenine Adenine Cytosine
So, in short, the 'name for human mitochondrial DNA' is not 207,000+ letters, but 207,000+ WORDS.

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it
__________________
GEEK CODE V.3.12: GCS/E d-- s: a-- C++ US+ P+ L++ E--- W+++ N+ !o? K- w-- !O M++ V? PS+ PE Y+ PGP t- 5++ X R !tv-- b+++ DI++ D+ G+ e+++ h !r*-- y?
SE4 CODE: A-- Se+++* GdY $?/++ Fr! C++* Css Sf Ai Au- M+ MpN S Ss- RV Pw- Fq-- Nd Rp+ G- Mm++ Bb@ Tcp- L+
Reply With Quote
  #20  
Old December 26th, 2003, 08:53 AM
narf poit chez BOOM's Avatar

narf poit chez BOOM narf poit chez BOOM is offline
Shrapnel Fanatic
 
Join Date: Mar 2003
Location: CHEESE!
Posts: 10,009
Thanks: 0
Thanked 7 Times in 1 Post
narf poit chez BOOM is on a distinguished road
Default Re: OT: is this real?

Quote:
Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it
and here i am, going to all the trouble of being witty!
__________________
If I only could remember half the things I'd forgot, that would be a lot of stuff, I think - I don't know; I forgot!
A* E* Se! Gd! $-- C-^- Ai** M-- S? Ss---- RA Pw? Fq Bb++@ Tcp? L++++
Some of my webcomics. I've got 400+ webcomics at Last count, some dead.
Sig updated to remove non-working links.
Reply With Quote
Reply

Bookmarks


Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is On

Forum Jump


All times are GMT -4. The time now is 09:45 PM.


Powered by vBulletin® Version 3.8.1
Copyright ©2000 - 2024, Jelsoft Enterprises Ltd.
Copyright ©1999 - 2024, Shrapnel Games, Inc. - All Rights Reserved.