OT: is this real?

[Fyron]

Lets try this again. Is tetrachloride a "word"?

[Puke]

I consider "tetrachloride" to be a word. I do NOT consider the chemical representation of tetrachloride, "Cl4", to be a word. Thus, I do not consider ACGTTACGG to be a word, even though it does convey meaning.

I am hard pressed to come up with a strict definition, but it would probably involve being a component of language which can be used to construct a sentence or phrase. the simple ability to convey meaning is too broad, and my definition above is too poor. someone else will have to do better, but i think my first paragraph sums up the opinion of those arguing against Fyron.

[Will]

Considering the translation of the bases of DNA as a word is too much of a stretch on the definition for me. I'm not saying that things that might not be able to be communicated to another human being only verbally (ie, narf's original link) wouldn't be considered words. The sheer number of prefixes would prevent someone from being able to understand it completely just from the sound. However, it is properly constructed with English syllables, and it can be understood as an *English* word by stepping through it slowly.

DNA, however, simply consists of a long code of four letters, each one of which stands for a single word in itself. So the 'word' GGTGACTACGGTTTACAAAC is not a 20-character word, but rather a representation of a string of 20 words:
Guanine Guanine Thymine Guanine Adenine Cytosine Thymine Adenine Cytosine Guanine Guanine Thymine Thymine Thymine Adenine Cytosine Adenine Adenine Adenine Cytosine
So, in short, the 'name for human mitochondrial DNA' is not 207,000+ letters, but 207,000+ WORDS.

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it

[narf poit chez BOOM]

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it

and here i am, going to all the trouble of being witty!

[Fyron]

I never said that GTTACA was a word... quite the contrary. That is not what they are talking about when they mention the full length word for DNA. That is NOT any particular DNA strand.

And even if you do not like DNA, the word mentioned at the beginning of this thread must be a word if tetrachloride is a word, because they are exactly the same thing, the word-representation of a chemical. They convey exactly as much meaning as "dog," "mouse," "puke," etc. convey, that of a noun.

[narf poit chez BOOM]

besides, many words are made up of other words.

[Puke]

i never claimed the word originating this thread was unwordly. just dna code and symbolic formulae.